ID: 938101469

View in Genome Browser
Species Human (GRCh38)
Location 2:128500614-128500636
Sequence GCTTAGGGATGCAACCGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938101464_938101469 27 Left 938101464 2:128500564-128500586 CCCTGGCCATTCAGAAAAAATTT No data
Right 938101469 2:128500614-128500636 GCTTAGGGATGCAACCGCACAGG No data
938101465_938101469 26 Left 938101465 2:128500565-128500587 CCTGGCCATTCAGAAAAAATTTA No data
Right 938101469 2:128500614-128500636 GCTTAGGGATGCAACCGCACAGG No data
938101466_938101469 21 Left 938101466 2:128500570-128500592 CCATTCAGAAAAAATTTAAAATA No data
Right 938101469 2:128500614-128500636 GCTTAGGGATGCAACCGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938101469 Original CRISPR GCTTAGGGATGCAACCGCAC AGG Intergenic
No off target data available for this crispr