ID: 938101554

View in Genome Browser
Species Human (GRCh38)
Location 2:128501166-128501188
Sequence GAGCCTCCTCACCCACTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938101554_938101557 -8 Left 938101554 2:128501166-128501188 CCCTGGAGTGGGTGAGGAGGCTC No data
Right 938101557 2:128501181-128501203 GGAGGCTCAGCGGCTGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938101554 Original CRISPR GAGCCTCCTCACCCACTCCA GGG (reversed) Intergenic
No off target data available for this crispr