ID: 938105353

View in Genome Browser
Species Human (GRCh38)
Location 2:128526312-128526334
Sequence CAGGAGAACCAGAGGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938105353_938105360 -3 Left 938105353 2:128526312-128526334 CCACCCTCCCTCTGGTTCTCCTG No data
Right 938105360 2:128526332-128526354 CTGCTCCAGGCAGTGCTCCTTGG No data
938105353_938105363 19 Left 938105353 2:128526312-128526334 CCACCCTCCCTCTGGTTCTCCTG No data
Right 938105363 2:128526354-128526376 GCTTCCTTCAGCCACCTGACTGG No data
938105353_938105365 26 Left 938105353 2:128526312-128526334 CCACCCTCCCTCTGGTTCTCCTG No data
Right 938105365 2:128526361-128526383 TCAGCCACCTGACTGGCCTCAGG No data
938105353_938105366 27 Left 938105353 2:128526312-128526334 CCACCCTCCCTCTGGTTCTCCTG No data
Right 938105366 2:128526362-128526384 CAGCCACCTGACTGGCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938105353 Original CRISPR CAGGAGAACCAGAGGGAGGG TGG (reversed) Intergenic
No off target data available for this crispr