ID: 938105723

View in Genome Browser
Species Human (GRCh38)
Location 2:128528609-128528631
Sequence GAGAAGGGAAGCAACTTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938105710_938105723 20 Left 938105710 2:128528566-128528588 CCGCAGAGATCATTCATTTTGTG No data
Right 938105723 2:128528609-128528631 GAGAAGGGAAGCAACTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938105723 Original CRISPR GAGAAGGGAAGCAACTTCCC AGG Intergenic
No off target data available for this crispr