ID: 938109110

View in Genome Browser
Species Human (GRCh38)
Location 2:128552438-128552460
Sequence GGATTCCCATGCAGGTGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938109110_938109124 23 Left 938109110 2:128552438-128552460 CCCAGACACCTGCATGGGAATCC No data
Right 938109124 2:128552484-128552506 TCAGCACCTCTATACTGGTGGGG No data
938109110_938109125 24 Left 938109110 2:128552438-128552460 CCCAGACACCTGCATGGGAATCC No data
Right 938109125 2:128552485-128552507 CAGCACCTCTATACTGGTGGGGG No data
938109110_938109126 25 Left 938109110 2:128552438-128552460 CCCAGACACCTGCATGGGAATCC No data
Right 938109126 2:128552486-128552508 AGCACCTCTATACTGGTGGGGGG No data
938109110_938109121 18 Left 938109110 2:128552438-128552460 CCCAGACACCTGCATGGGAATCC No data
Right 938109121 2:128552479-128552501 CTGAATCAGCACCTCTATACTGG No data
938109110_938109123 22 Left 938109110 2:128552438-128552460 CCCAGACACCTGCATGGGAATCC No data
Right 938109123 2:128552483-128552505 ATCAGCACCTCTATACTGGTGGG No data
938109110_938109122 21 Left 938109110 2:128552438-128552460 CCCAGACACCTGCATGGGAATCC No data
Right 938109122 2:128552482-128552504 AATCAGCACCTCTATACTGGTGG No data
938109110_938109113 -9 Left 938109110 2:128552438-128552460 CCCAGACACCTGCATGGGAATCC No data
Right 938109113 2:128552452-128552474 TGGGAATCCAGACCCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938109110 Original CRISPR GGATTCCCATGCAGGTGTCT GGG (reversed) Intergenic
No off target data available for this crispr