ID: 938109112

View in Genome Browser
Species Human (GRCh38)
Location 2:128552446-128552468
Sequence GTGGGTCTGGATTCCCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938109112_938109123 14 Left 938109112 2:128552446-128552468 CCTGCATGGGAATCCAGACCCAC No data
Right 938109123 2:128552483-128552505 ATCAGCACCTCTATACTGGTGGG No data
938109112_938109126 17 Left 938109112 2:128552446-128552468 CCTGCATGGGAATCCAGACCCAC No data
Right 938109126 2:128552486-128552508 AGCACCTCTATACTGGTGGGGGG No data
938109112_938109124 15 Left 938109112 2:128552446-128552468 CCTGCATGGGAATCCAGACCCAC No data
Right 938109124 2:128552484-128552506 TCAGCACCTCTATACTGGTGGGG No data
938109112_938109121 10 Left 938109112 2:128552446-128552468 CCTGCATGGGAATCCAGACCCAC No data
Right 938109121 2:128552479-128552501 CTGAATCAGCACCTCTATACTGG No data
938109112_938109125 16 Left 938109112 2:128552446-128552468 CCTGCATGGGAATCCAGACCCAC No data
Right 938109125 2:128552485-128552507 CAGCACCTCTATACTGGTGGGGG No data
938109112_938109122 13 Left 938109112 2:128552446-128552468 CCTGCATGGGAATCCAGACCCAC No data
Right 938109122 2:128552482-128552504 AATCAGCACCTCTATACTGGTGG No data
938109112_938109128 26 Left 938109112 2:128552446-128552468 CCTGCATGGGAATCCAGACCCAC No data
Right 938109128 2:128552495-128552517 ATACTGGTGGGGGGCTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938109112 Original CRISPR GTGGGTCTGGATTCCCATGC AGG (reversed) Intergenic
No off target data available for this crispr