ID: 938109113

View in Genome Browser
Species Human (GRCh38)
Location 2:128552452-128552474
Sequence TGGGAATCCAGACCCACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938109107_938109113 18 Left 938109107 2:128552411-128552433 CCTGGGTGGAGATGGGAAGCTCT No data
Right 938109113 2:128552452-128552474 TGGGAATCCAGACCCACCCCAGG No data
938109111_938109113 -10 Left 938109111 2:128552439-128552461 CCAGACACCTGCATGGGAATCCA No data
Right 938109113 2:128552452-128552474 TGGGAATCCAGACCCACCCCAGG No data
938109103_938109113 29 Left 938109103 2:128552400-128552422 CCTGCAGATGCCCTGGGTGGAGA No data
Right 938109113 2:128552452-128552474 TGGGAATCCAGACCCACCCCAGG No data
938109106_938109113 19 Left 938109106 2:128552410-128552432 CCCTGGGTGGAGATGGGAAGCTC No data
Right 938109113 2:128552452-128552474 TGGGAATCCAGACCCACCCCAGG No data
938109110_938109113 -9 Left 938109110 2:128552438-128552460 CCCAGACACCTGCATGGGAATCC No data
Right 938109113 2:128552452-128552474 TGGGAATCCAGACCCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938109113 Original CRISPR TGGGAATCCAGACCCACCCC AGG Intergenic
No off target data available for this crispr