ID: 938109115

View in Genome Browser
Species Human (GRCh38)
Location 2:128552464-128552486
Sequence TGATTCAGCAGGCCTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938109115_938109131 27 Left 938109115 2:128552464-128552486 CCCACCCCAGGCCTGCTGAATCA No data
Right 938109131 2:128552514-128552536 CAGGAACTGCACATCAACAATGG No data
938109115_938109125 -2 Left 938109115 2:128552464-128552486 CCCACCCCAGGCCTGCTGAATCA No data
Right 938109125 2:128552485-128552507 CAGCACCTCTATACTGGTGGGGG No data
938109115_938109126 -1 Left 938109115 2:128552464-128552486 CCCACCCCAGGCCTGCTGAATCA No data
Right 938109126 2:128552486-128552508 AGCACCTCTATACTGGTGGGGGG No data
938109115_938109124 -3 Left 938109115 2:128552464-128552486 CCCACCCCAGGCCTGCTGAATCA No data
Right 938109124 2:128552484-128552506 TCAGCACCTCTATACTGGTGGGG No data
938109115_938109122 -5 Left 938109115 2:128552464-128552486 CCCACCCCAGGCCTGCTGAATCA No data
Right 938109122 2:128552482-128552504 AATCAGCACCTCTATACTGGTGG No data
938109115_938109121 -8 Left 938109115 2:128552464-128552486 CCCACCCCAGGCCTGCTGAATCA No data
Right 938109121 2:128552479-128552501 CTGAATCAGCACCTCTATACTGG No data
938109115_938109123 -4 Left 938109115 2:128552464-128552486 CCCACCCCAGGCCTGCTGAATCA No data
Right 938109123 2:128552483-128552505 ATCAGCACCTCTATACTGGTGGG No data
938109115_938109128 8 Left 938109115 2:128552464-128552486 CCCACCCCAGGCCTGCTGAATCA No data
Right 938109128 2:128552495-128552517 ATACTGGTGGGGGGCTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938109115 Original CRISPR TGATTCAGCAGGCCTGGGGT GGG (reversed) Intergenic
No off target data available for this crispr