ID: 938109121

View in Genome Browser
Species Human (GRCh38)
Location 2:128552479-128552501
Sequence CTGAATCAGCACCTCTATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938109114_938109121 -3 Left 938109114 2:128552459-128552481 CCAGACCCACCCCAGGCCTGCTG No data
Right 938109121 2:128552479-128552501 CTGAATCAGCACCTCTATACTGG No data
938109116_938109121 -9 Left 938109116 2:128552465-128552487 CCACCCCAGGCCTGCTGAATCAG No data
Right 938109121 2:128552479-128552501 CTGAATCAGCACCTCTATACTGG No data
938109111_938109121 17 Left 938109111 2:128552439-128552461 CCAGACACCTGCATGGGAATCCA No data
Right 938109121 2:128552479-128552501 CTGAATCAGCACCTCTATACTGG No data
938109115_938109121 -8 Left 938109115 2:128552464-128552486 CCCACCCCAGGCCTGCTGAATCA No data
Right 938109121 2:128552479-128552501 CTGAATCAGCACCTCTATACTGG No data
938109110_938109121 18 Left 938109110 2:128552438-128552460 CCCAGACACCTGCATGGGAATCC No data
Right 938109121 2:128552479-128552501 CTGAATCAGCACCTCTATACTGG No data
938109112_938109121 10 Left 938109112 2:128552446-128552468 CCTGCATGGGAATCCAGACCCAC No data
Right 938109121 2:128552479-128552501 CTGAATCAGCACCTCTATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938109121 Original CRISPR CTGAATCAGCACCTCTATAC TGG Intergenic
No off target data available for this crispr