ID: 938109125

View in Genome Browser
Species Human (GRCh38)
Location 2:128552485-128552507
Sequence CAGCACCTCTATACTGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938109116_938109125 -3 Left 938109116 2:128552465-128552487 CCACCCCAGGCCTGCTGAATCAG No data
Right 938109125 2:128552485-128552507 CAGCACCTCTATACTGGTGGGGG No data
938109118_938109125 -7 Left 938109118 2:128552469-128552491 CCCAGGCCTGCTGAATCAGCACC No data
Right 938109125 2:128552485-128552507 CAGCACCTCTATACTGGTGGGGG No data
938109114_938109125 3 Left 938109114 2:128552459-128552481 CCAGACCCACCCCAGGCCTGCTG No data
Right 938109125 2:128552485-128552507 CAGCACCTCTATACTGGTGGGGG No data
938109110_938109125 24 Left 938109110 2:128552438-128552460 CCCAGACACCTGCATGGGAATCC No data
Right 938109125 2:128552485-128552507 CAGCACCTCTATACTGGTGGGGG No data
938109111_938109125 23 Left 938109111 2:128552439-128552461 CCAGACACCTGCATGGGAATCCA No data
Right 938109125 2:128552485-128552507 CAGCACCTCTATACTGGTGGGGG No data
938109119_938109125 -8 Left 938109119 2:128552470-128552492 CCAGGCCTGCTGAATCAGCACCT No data
Right 938109125 2:128552485-128552507 CAGCACCTCTATACTGGTGGGGG No data
938109117_938109125 -6 Left 938109117 2:128552468-128552490 CCCCAGGCCTGCTGAATCAGCAC No data
Right 938109125 2:128552485-128552507 CAGCACCTCTATACTGGTGGGGG No data
938109112_938109125 16 Left 938109112 2:128552446-128552468 CCTGCATGGGAATCCAGACCCAC No data
Right 938109125 2:128552485-128552507 CAGCACCTCTATACTGGTGGGGG No data
938109115_938109125 -2 Left 938109115 2:128552464-128552486 CCCACCCCAGGCCTGCTGAATCA No data
Right 938109125 2:128552485-128552507 CAGCACCTCTATACTGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938109125 Original CRISPR CAGCACCTCTATACTGGTGG GGG Intergenic
No off target data available for this crispr