ID: 938109128

View in Genome Browser
Species Human (GRCh38)
Location 2:128552495-128552517
Sequence ATACTGGTGGGGGGCTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938109117_938109128 4 Left 938109117 2:128552468-128552490 CCCCAGGCCTGCTGAATCAGCAC No data
Right 938109128 2:128552495-128552517 ATACTGGTGGGGGGCTGCCCAGG No data
938109114_938109128 13 Left 938109114 2:128552459-128552481 CCAGACCCACCCCAGGCCTGCTG No data
Right 938109128 2:128552495-128552517 ATACTGGTGGGGGGCTGCCCAGG No data
938109115_938109128 8 Left 938109115 2:128552464-128552486 CCCACCCCAGGCCTGCTGAATCA No data
Right 938109128 2:128552495-128552517 ATACTGGTGGGGGGCTGCCCAGG No data
938109112_938109128 26 Left 938109112 2:128552446-128552468 CCTGCATGGGAATCCAGACCCAC No data
Right 938109128 2:128552495-128552517 ATACTGGTGGGGGGCTGCCCAGG No data
938109116_938109128 7 Left 938109116 2:128552465-128552487 CCACCCCAGGCCTGCTGAATCAG No data
Right 938109128 2:128552495-128552517 ATACTGGTGGGGGGCTGCCCAGG No data
938109120_938109128 -3 Left 938109120 2:128552475-128552497 CCTGCTGAATCAGCACCTCTATA No data
Right 938109128 2:128552495-128552517 ATACTGGTGGGGGGCTGCCCAGG No data
938109118_938109128 3 Left 938109118 2:128552469-128552491 CCCAGGCCTGCTGAATCAGCACC No data
Right 938109128 2:128552495-128552517 ATACTGGTGGGGGGCTGCCCAGG No data
938109119_938109128 2 Left 938109119 2:128552470-128552492 CCAGGCCTGCTGAATCAGCACCT No data
Right 938109128 2:128552495-128552517 ATACTGGTGGGGGGCTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938109128 Original CRISPR ATACTGGTGGGGGGCTGCCC AGG Intergenic
No off target data available for this crispr