ID: 938111681

View in Genome Browser
Species Human (GRCh38)
Location 2:128571806-128571828
Sequence GTGCCCTAATTGAAGAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938111681_938111684 0 Left 938111681 2:128571806-128571828 CCAGCCCTCTTCAATTAGGGCAC No data
Right 938111684 2:128571829-128571851 AAACAAGATTAATTTTTTCCTGG No data
938111681_938111687 22 Left 938111681 2:128571806-128571828 CCAGCCCTCTTCAATTAGGGCAC No data
Right 938111687 2:128571851-128571873 GCAAGTCGATGTAGATGGTTTGG No data
938111681_938111688 30 Left 938111681 2:128571806-128571828 CCAGCCCTCTTCAATTAGGGCAC No data
Right 938111688 2:128571859-128571881 ATGTAGATGGTTTGGTGCTGTGG No data
938111681_938111685 17 Left 938111681 2:128571806-128571828 CCAGCCCTCTTCAATTAGGGCAC No data
Right 938111685 2:128571846-128571868 TCCTGGCAAGTCGATGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938111681 Original CRISPR GTGCCCTAATTGAAGAGGGC TGG (reversed) Intergenic
No off target data available for this crispr