ID: 938118820

View in Genome Browser
Species Human (GRCh38)
Location 2:128619902-128619924
Sequence TGACACAGCCAGGATTTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938118811_938118820 11 Left 938118811 2:128619868-128619890 CCAGTGGGGGAACTGAGGCCTGG No data
Right 938118820 2:128619902-128619924 TGACACAGCCAGGATTTGAGTGG No data
938118809_938118820 15 Left 938118809 2:128619864-128619886 CCCTCCAGTGGGGGAACTGAGGC No data
Right 938118820 2:128619902-128619924 TGACACAGCCAGGATTTGAGTGG No data
938118818_938118820 -7 Left 938118818 2:128619886-128619908 CCTGGGGCGGGCAGGATGACACA No data
Right 938118820 2:128619902-128619924 TGACACAGCCAGGATTTGAGTGG No data
938118806_938118820 19 Left 938118806 2:128619860-128619882 CCACCCCTCCAGTGGGGGAACTG No data
Right 938118820 2:128619902-128619924 TGACACAGCCAGGATTTGAGTGG No data
938118807_938118820 16 Left 938118807 2:128619863-128619885 CCCCTCCAGTGGGGGAACTGAGG No data
Right 938118820 2:128619902-128619924 TGACACAGCCAGGATTTGAGTGG No data
938118810_938118820 14 Left 938118810 2:128619865-128619887 CCTCCAGTGGGGGAACTGAGGCC No data
Right 938118820 2:128619902-128619924 TGACACAGCCAGGATTTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938118820 Original CRISPR TGACACAGCCAGGATTTGAG TGG Intergenic
No off target data available for this crispr