ID: 938119984

View in Genome Browser
Species Human (GRCh38)
Location 2:128626443-128626465
Sequence GTGTGCAAGGGGGAGATGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938119984_938119996 12 Left 938119984 2:128626443-128626465 CCCCACATCTCCCCCTTGCACAC No data
Right 938119996 2:128626478-128626500 TCCTTCATGTGAAGAGGTGGTGG No data
938119984_938119998 19 Left 938119984 2:128626443-128626465 CCCCACATCTCCCCCTTGCACAC No data
Right 938119998 2:128626485-128626507 TGTGAAGAGGTGGTGGCACCTGG No data
938119984_938120000 29 Left 938119984 2:128626443-128626465 CCCCACATCTCCCCCTTGCACAC No data
Right 938120000 2:128626495-128626517 TGGTGGCACCTGGGCATGTGTGG No data
938119984_938119995 9 Left 938119984 2:128626443-128626465 CCCCACATCTCCCCCTTGCACAC No data
Right 938119995 2:128626475-128626497 ATGTCCTTCATGTGAAGAGGTGG No data
938119984_938119999 20 Left 938119984 2:128626443-128626465 CCCCACATCTCCCCCTTGCACAC No data
Right 938119999 2:128626486-128626508 GTGAAGAGGTGGTGGCACCTGGG No data
938119984_938119994 6 Left 938119984 2:128626443-128626465 CCCCACATCTCCCCCTTGCACAC No data
Right 938119994 2:128626472-128626494 TTCATGTCCTTCATGTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938119984 Original CRISPR GTGTGCAAGGGGGAGATGTG GGG (reversed) Intergenic
No off target data available for this crispr