ID: 938120204

View in Genome Browser
Species Human (GRCh38)
Location 2:128627670-128627692
Sequence ACAATCAGTCTGGGGTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938120204_938120209 -1 Left 938120204 2:128627670-128627692 CCTCCTTACCCCAGACTGATTGT No data
Right 938120209 2:128627692-128627714 TGCTGTAGCAGAGACAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938120204 Original CRISPR ACAATCAGTCTGGGGTAAGG AGG (reversed) Intergenic