ID: 938122874

View in Genome Browser
Species Human (GRCh38)
Location 2:128645958-128645980
Sequence ATGAATGAGTAGAGGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938122874_938122879 2 Left 938122874 2:128645958-128645980 CCTTGTTCCCTCTACTCATTCAT No data
Right 938122879 2:128645983-128646005 AACAGGAAACAGAGCCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938122874 Original CRISPR ATGAATGAGTAGAGGGAACA AGG (reversed) Intergenic
No off target data available for this crispr