ID: 938123058

View in Genome Browser
Species Human (GRCh38)
Location 2:128647088-128647110
Sequence TGCCCAGCACCACCCCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938123046_938123058 23 Left 938123046 2:128647042-128647064 CCCTACAGCAGGTGGGGATGAGG No data
Right 938123058 2:128647088-128647110 TGCCCAGCACCACCCCAGAGGGG No data
938123054_938123058 -8 Left 938123054 2:128647073-128647095 CCCTGGAACAGGAGCTGCCCAGC No data
Right 938123058 2:128647088-128647110 TGCCCAGCACCACCCCAGAGGGG No data
938123053_938123058 -7 Left 938123053 2:128647072-128647094 CCCCTGGAACAGGAGCTGCCCAG No data
Right 938123058 2:128647088-128647110 TGCCCAGCACCACCCCAGAGGGG No data
938123048_938123058 22 Left 938123048 2:128647043-128647065 CCTACAGCAGGTGGGGATGAGGA No data
Right 938123058 2:128647088-128647110 TGCCCAGCACCACCCCAGAGGGG No data
938123055_938123058 -9 Left 938123055 2:128647074-128647096 CCTGGAACAGGAGCTGCCCAGCA No data
Right 938123058 2:128647088-128647110 TGCCCAGCACCACCCCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938123058 Original CRISPR TGCCCAGCACCACCCCAGAG GGG Intergenic
No off target data available for this crispr