ID: 938125031

View in Genome Browser
Species Human (GRCh38)
Location 2:128665145-128665167
Sequence GCCCTCCCAGTGGTTCCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938125031_938125039 11 Left 938125031 2:128665145-128665167 CCAGGCGGAACCACTGGGAGGGC No data
Right 938125039 2:128665179-128665201 GGGCGAAGGCTGCCTCTACTTGG No data
938125031_938125036 -3 Left 938125031 2:128665145-128665167 CCAGGCGGAACCACTGGGAGGGC No data
Right 938125036 2:128665165-128665187 GGCGCTGGCCCACTGGGCGAAGG No data
938125031_938125042 25 Left 938125031 2:128665145-128665167 CCAGGCGGAACCACTGGGAGGGC No data
Right 938125042 2:128665193-128665215 TCTACTTGGGATGCCAGAAGAGG No data
938125031_938125035 -9 Left 938125031 2:128665145-128665167 CCAGGCGGAACCACTGGGAGGGC No data
Right 938125035 2:128665159-128665181 TGGGAGGGCGCTGGCCCACTGGG No data
938125031_938125040 12 Left 938125031 2:128665145-128665167 CCAGGCGGAACCACTGGGAGGGC No data
Right 938125040 2:128665180-128665202 GGCGAAGGCTGCCTCTACTTGGG No data
938125031_938125034 -10 Left 938125031 2:128665145-128665167 CCAGGCGGAACCACTGGGAGGGC No data
Right 938125034 2:128665158-128665180 CTGGGAGGGCGCTGGCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938125031 Original CRISPR GCCCTCCCAGTGGTTCCGCC TGG (reversed) Intergenic