ID: 938128981

View in Genome Browser
Species Human (GRCh38)
Location 2:128694547-128694569
Sequence ACCCTTGCAAAAGTAAACAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938128981_938128991 28 Left 938128981 2:128694547-128694569 CCGCTGTTTACTTTTGCAAGGGT No data
Right 938128991 2:128694598-128694620 GCTGGCCTCAGGCCTCCCCTGGG 0: 1
1: 0
2: 3
3: 35
4: 438
938128981_938128987 17 Left 938128981 2:128694547-128694569 CCGCTGTTTACTTTTGCAAGGGT No data
Right 938128987 2:128694587-128694609 ACCCGGTGTGTGCTGGCCTCAGG No data
938128981_938128992 29 Left 938128981 2:128694547-128694569 CCGCTGTTTACTTTTGCAAGGGT No data
Right 938128992 2:128694599-128694621 CTGGCCTCAGGCCTCCCCTGGGG No data
938128981_938128990 27 Left 938128981 2:128694547-128694569 CCGCTGTTTACTTTTGCAAGGGT No data
Right 938128990 2:128694597-128694619 TGCTGGCCTCAGGCCTCCCCTGG No data
938128981_938128985 10 Left 938128981 2:128694547-128694569 CCGCTGTTTACTTTTGCAAGGGT No data
Right 938128985 2:128694580-128694602 CCTCCTGACCCGGTGTGTGCTGG No data
938128981_938128983 0 Left 938128981 2:128694547-128694569 CCGCTGTTTACTTTTGCAAGGGT No data
Right 938128983 2:128694570-128694592 AGTCGAGGCTCCTCCTGACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938128981 Original CRISPR ACCCTTGCAAAAGTAAACAG CGG (reversed) Intergenic