ID: 938128984

View in Genome Browser
Species Human (GRCh38)
Location 2:128694580-128694602
Sequence CCAGCACACACCGGGTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938128984_938128990 -6 Left 938128984 2:128694580-128694602 CCTCCTGACCCGGTGTGTGCTGG No data
Right 938128990 2:128694597-128694619 TGCTGGCCTCAGGCCTCCCCTGG No data
938128984_938128998 25 Left 938128984 2:128694580-128694602 CCTCCTGACCCGGTGTGTGCTGG No data
Right 938128998 2:128694628-128694650 TGCCCCGCAGCGTTGCCGTCTGG No data
938128984_938128991 -5 Left 938128984 2:128694580-128694602 CCTCCTGACCCGGTGTGTGCTGG No data
Right 938128991 2:128694598-128694620 GCTGGCCTCAGGCCTCCCCTGGG 0: 1
1: 0
2: 3
3: 35
4: 438
938128984_938128992 -4 Left 938128984 2:128694580-128694602 CCTCCTGACCCGGTGTGTGCTGG No data
Right 938128992 2:128694599-128694621 CTGGCCTCAGGCCTCCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938128984 Original CRISPR CCAGCACACACCGGGTCAGG AGG (reversed) Intergenic