ID: 938128986

View in Genome Browser
Species Human (GRCh38)
Location 2:128694583-128694605
Sequence AGGCCAGCACACACCGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938128986_938128992 -7 Left 938128986 2:128694583-128694605 CCTGACCCGGTGTGTGCTGGCCT No data
Right 938128992 2:128694599-128694621 CTGGCCTCAGGCCTCCCCTGGGG No data
938128986_938128991 -8 Left 938128986 2:128694583-128694605 CCTGACCCGGTGTGTGCTGGCCT No data
Right 938128991 2:128694598-128694620 GCTGGCCTCAGGCCTCCCCTGGG No data
938128986_938128998 22 Left 938128986 2:128694583-128694605 CCTGACCCGGTGTGTGCTGGCCT No data
Right 938128998 2:128694628-128694650 TGCCCCGCAGCGTTGCCGTCTGG No data
938128986_938128990 -9 Left 938128986 2:128694583-128694605 CCTGACCCGGTGTGTGCTGGCCT No data
Right 938128990 2:128694597-128694619 TGCTGGCCTCAGGCCTCCCCTGG No data
938128986_938129002 29 Left 938128986 2:128694583-128694605 CCTGACCCGGTGTGTGCTGGCCT No data
Right 938129002 2:128694635-128694657 CAGCGTTGCCGTCTGGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938128986 Original CRISPR AGGCCAGCACACACCGGGTC AGG (reversed) Intergenic