ID: 938128988

View in Genome Browser
Species Human (GRCh38)
Location 2:128694588-128694610
Sequence GCCTGAGGCCAGCACACACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938128988_938129002 24 Left 938128988 2:128694588-128694610 CCCGGTGTGTGCTGGCCTCAGGC No data
Right 938129002 2:128694635-128694657 CAGCGTTGCCGTCTGGTCTCTGG No data
938128988_938128998 17 Left 938128988 2:128694588-128694610 CCCGGTGTGTGCTGGCCTCAGGC No data
Right 938128998 2:128694628-128694650 TGCCCCGCAGCGTTGCCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938128988 Original CRISPR GCCTGAGGCCAGCACACACC GGG (reversed) Intergenic