ID: 938128989

View in Genome Browser
Species Human (GRCh38)
Location 2:128694589-128694611
Sequence GGCCTGAGGCCAGCACACAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938128989_938129002 23 Left 938128989 2:128694589-128694611 CCGGTGTGTGCTGGCCTCAGGCC No data
Right 938129002 2:128694635-128694657 CAGCGTTGCCGTCTGGTCTCTGG No data
938128989_938128998 16 Left 938128989 2:128694589-128694611 CCGGTGTGTGCTGGCCTCAGGCC No data
Right 938128998 2:128694628-128694650 TGCCCCGCAGCGTTGCCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938128989 Original CRISPR GGCCTGAGGCCAGCACACAC CGG (reversed) Intergenic