ID: 938128990

View in Genome Browser
Species Human (GRCh38)
Location 2:128694597-128694619
Sequence TGCTGGCCTCAGGCCTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938128981_938128990 27 Left 938128981 2:128694547-128694569 CCGCTGTTTACTTTTGCAAGGGT No data
Right 938128990 2:128694597-128694619 TGCTGGCCTCAGGCCTCCCCTGG No data
938128986_938128990 -9 Left 938128986 2:128694583-128694605 CCTGACCCGGTGTGTGCTGGCCT No data
Right 938128990 2:128694597-128694619 TGCTGGCCTCAGGCCTCCCCTGG No data
938128984_938128990 -6 Left 938128984 2:128694580-128694602 CCTCCTGACCCGGTGTGTGCTGG No data
Right 938128990 2:128694597-128694619 TGCTGGCCTCAGGCCTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938128990 Original CRISPR TGCTGGCCTCAGGCCTCCCC TGG Intergenic