ID: 938128992

View in Genome Browser
Species Human (GRCh38)
Location 2:128694599-128694621
Sequence CTGGCCTCAGGCCTCCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938128984_938128992 -4 Left 938128984 2:128694580-128694602 CCTCCTGACCCGGTGTGTGCTGG No data
Right 938128992 2:128694599-128694621 CTGGCCTCAGGCCTCCCCTGGGG No data
938128986_938128992 -7 Left 938128986 2:128694583-128694605 CCTGACCCGGTGTGTGCTGGCCT No data
Right 938128992 2:128694599-128694621 CTGGCCTCAGGCCTCCCCTGGGG No data
938128981_938128992 29 Left 938128981 2:128694547-128694569 CCGCTGTTTACTTTTGCAAGGGT No data
Right 938128992 2:128694599-128694621 CTGGCCTCAGGCCTCCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938128992 Original CRISPR CTGGCCTCAGGCCTCCCCTG GGG Intergenic