ID: 938128994

View in Genome Browser
Species Human (GRCh38)
Location 2:128694610-128694632
Sequence GGGCAGCATCACCCCAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938128994_938129004 15 Left 938128994 2:128694610-128694632 CCTCCCCTGGGGTGATGCTGCCC No data
Right 938129004 2:128694648-128694670 TGGTCTCTGGCCCCTGCCTGTGG No data
938128994_938129002 2 Left 938128994 2:128694610-128694632 CCTCCCCTGGGGTGATGCTGCCC No data
Right 938129002 2:128694635-128694657 CAGCGTTGCCGTCTGGTCTCTGG No data
938128994_938129005 21 Left 938128994 2:128694610-128694632 CCTCCCCTGGGGTGATGCTGCCC No data
Right 938129005 2:128694654-128694676 CTGGCCCCTGCCTGTGGCCATGG No data
938128994_938128998 -5 Left 938128994 2:128694610-128694632 CCTCCCCTGGGGTGATGCTGCCC No data
Right 938128998 2:128694628-128694650 TGCCCCGCAGCGTTGCCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938128994 Original CRISPR GGGCAGCATCACCCCAGGGG AGG (reversed) Intergenic