ID: 938128995

View in Genome Browser
Species Human (GRCh38)
Location 2:128694613-128694635
Sequence GCGGGGCAGCATCACCCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938128995_938128998 -8 Left 938128995 2:128694613-128694635 CCCCTGGGGTGATGCTGCCCCGC No data
Right 938128998 2:128694628-128694650 TGCCCCGCAGCGTTGCCGTCTGG No data
938128995_938129005 18 Left 938128995 2:128694613-128694635 CCCCTGGGGTGATGCTGCCCCGC No data
Right 938129005 2:128694654-128694676 CTGGCCCCTGCCTGTGGCCATGG No data
938128995_938129004 12 Left 938128995 2:128694613-128694635 CCCCTGGGGTGATGCTGCCCCGC No data
Right 938129004 2:128694648-128694670 TGGTCTCTGGCCCCTGCCTGTGG No data
938128995_938129002 -1 Left 938128995 2:128694613-128694635 CCCCTGGGGTGATGCTGCCCCGC No data
Right 938129002 2:128694635-128694657 CAGCGTTGCCGTCTGGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938128995 Original CRISPR GCGGGGCAGCATCACCCCAG GGG (reversed) Intergenic