ID: 938128997

View in Genome Browser
Species Human (GRCh38)
Location 2:128694615-128694637
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938128997_938129002 -3 Left 938128997 2:128694615-128694637 CCTGGGGTGATGCTGCCCCGCAG No data
Right 938129002 2:128694635-128694657 CAGCGTTGCCGTCTGGTCTCTGG No data
938128997_938129005 16 Left 938128997 2:128694615-128694637 CCTGGGGTGATGCTGCCCCGCAG No data
Right 938129005 2:128694654-128694676 CTGGCCCCTGCCTGTGGCCATGG No data
938128997_938128998 -10 Left 938128997 2:128694615-128694637 CCTGGGGTGATGCTGCCCCGCAG No data
Right 938128998 2:128694628-128694650 TGCCCCGCAGCGTTGCCGTCTGG No data
938128997_938129004 10 Left 938128997 2:128694615-128694637 CCTGGGGTGATGCTGCCCCGCAG No data
Right 938129004 2:128694648-128694670 TGGTCTCTGGCCCCTGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938128997 Original CRISPR CTGCGGGGCAGCATCACCCC AGG (reversed) Intergenic