ID: 938128998

View in Genome Browser
Species Human (GRCh38)
Location 2:128694628-128694650
Sequence TGCCCCGCAGCGTTGCCGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938128989_938128998 16 Left 938128989 2:128694589-128694611 CCGGTGTGTGCTGGCCTCAGGCC No data
Right 938128998 2:128694628-128694650 TGCCCCGCAGCGTTGCCGTCTGG No data
938128984_938128998 25 Left 938128984 2:128694580-128694602 CCTCCTGACCCGGTGTGTGCTGG No data
Right 938128998 2:128694628-128694650 TGCCCCGCAGCGTTGCCGTCTGG No data
938128994_938128998 -5 Left 938128994 2:128694610-128694632 CCTCCCCTGGGGTGATGCTGCCC No data
Right 938128998 2:128694628-128694650 TGCCCCGCAGCGTTGCCGTCTGG No data
938128995_938128998 -8 Left 938128995 2:128694613-128694635 CCCCTGGGGTGATGCTGCCCCGC No data
Right 938128998 2:128694628-128694650 TGCCCCGCAGCGTTGCCGTCTGG No data
938128986_938128998 22 Left 938128986 2:128694583-128694605 CCTGACCCGGTGTGTGCTGGCCT No data
Right 938128998 2:128694628-128694650 TGCCCCGCAGCGTTGCCGTCTGG No data
938128996_938128998 -9 Left 938128996 2:128694614-128694636 CCCTGGGGTGATGCTGCCCCGCA No data
Right 938128998 2:128694628-128694650 TGCCCCGCAGCGTTGCCGTCTGG No data
938128988_938128998 17 Left 938128988 2:128694588-128694610 CCCGGTGTGTGCTGGCCTCAGGC No data
Right 938128998 2:128694628-128694650 TGCCCCGCAGCGTTGCCGTCTGG No data
938128997_938128998 -10 Left 938128997 2:128694615-128694637 CCTGGGGTGATGCTGCCCCGCAG No data
Right 938128998 2:128694628-128694650 TGCCCCGCAGCGTTGCCGTCTGG No data
938128993_938128998 2 Left 938128993 2:128694603-128694625 CCTCAGGCCTCCCCTGGGGTGAT No data
Right 938128998 2:128694628-128694650 TGCCCCGCAGCGTTGCCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938128998 Original CRISPR TGCCCCGCAGCGTTGCCGTC TGG Intergenic