ID: 938129002

View in Genome Browser
Species Human (GRCh38)
Location 2:128694635-128694657
Sequence CAGCGTTGCCGTCTGGTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938128988_938129002 24 Left 938128988 2:128694588-128694610 CCCGGTGTGTGCTGGCCTCAGGC No data
Right 938129002 2:128694635-128694657 CAGCGTTGCCGTCTGGTCTCTGG No data
938128989_938129002 23 Left 938128989 2:128694589-128694611 CCGGTGTGTGCTGGCCTCAGGCC No data
Right 938129002 2:128694635-128694657 CAGCGTTGCCGTCTGGTCTCTGG No data
938128995_938129002 -1 Left 938128995 2:128694613-128694635 CCCCTGGGGTGATGCTGCCCCGC No data
Right 938129002 2:128694635-128694657 CAGCGTTGCCGTCTGGTCTCTGG No data
938128994_938129002 2 Left 938128994 2:128694610-128694632 CCTCCCCTGGGGTGATGCTGCCC No data
Right 938129002 2:128694635-128694657 CAGCGTTGCCGTCTGGTCTCTGG No data
938128986_938129002 29 Left 938128986 2:128694583-128694605 CCTGACCCGGTGTGTGCTGGCCT No data
Right 938129002 2:128694635-128694657 CAGCGTTGCCGTCTGGTCTCTGG No data
938128997_938129002 -3 Left 938128997 2:128694615-128694637 CCTGGGGTGATGCTGCCCCGCAG No data
Right 938129002 2:128694635-128694657 CAGCGTTGCCGTCTGGTCTCTGG No data
938128993_938129002 9 Left 938128993 2:128694603-128694625 CCTCAGGCCTCCCCTGGGGTGAT No data
Right 938129002 2:128694635-128694657 CAGCGTTGCCGTCTGGTCTCTGG No data
938128996_938129002 -2 Left 938128996 2:128694614-128694636 CCCTGGGGTGATGCTGCCCCGCA No data
Right 938129002 2:128694635-128694657 CAGCGTTGCCGTCTGGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938129002 Original CRISPR CAGCGTTGCCGTCTGGTCTC TGG Intergenic