ID: 938129004

View in Genome Browser
Species Human (GRCh38)
Location 2:128694648-128694670
Sequence TGGTCTCTGGCCCCTGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938128994_938129004 15 Left 938128994 2:128694610-128694632 CCTCCCCTGGGGTGATGCTGCCC No data
Right 938129004 2:128694648-128694670 TGGTCTCTGGCCCCTGCCTGTGG No data
938128996_938129004 11 Left 938128996 2:128694614-128694636 CCCTGGGGTGATGCTGCCCCGCA No data
Right 938129004 2:128694648-128694670 TGGTCTCTGGCCCCTGCCTGTGG No data
938128995_938129004 12 Left 938128995 2:128694613-128694635 CCCCTGGGGTGATGCTGCCCCGC No data
Right 938129004 2:128694648-128694670 TGGTCTCTGGCCCCTGCCTGTGG No data
938128993_938129004 22 Left 938128993 2:128694603-128694625 CCTCAGGCCTCCCCTGGGGTGAT No data
Right 938129004 2:128694648-128694670 TGGTCTCTGGCCCCTGCCTGTGG No data
938129000_938129004 -6 Left 938129000 2:128694631-128694653 CCCGCAGCGTTGCCGTCTGGTCT No data
Right 938129004 2:128694648-128694670 TGGTCTCTGGCCCCTGCCTGTGG No data
938128997_938129004 10 Left 938128997 2:128694615-128694637 CCTGGGGTGATGCTGCCCCGCAG No data
Right 938129004 2:128694648-128694670 TGGTCTCTGGCCCCTGCCTGTGG No data
938128999_938129004 -5 Left 938128999 2:128694630-128694652 CCCCGCAGCGTTGCCGTCTGGTC No data
Right 938129004 2:128694648-128694670 TGGTCTCTGGCCCCTGCCTGTGG No data
938129001_938129004 -7 Left 938129001 2:128694632-128694654 CCGCAGCGTTGCCGTCTGGTCTC No data
Right 938129004 2:128694648-128694670 TGGTCTCTGGCCCCTGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938129004 Original CRISPR TGGTCTCTGGCCCCTGCCTG TGG Intergenic