ID: 938129005

View in Genome Browser
Species Human (GRCh38)
Location 2:128694654-128694676
Sequence CTGGCCCCTGCCTGTGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938128993_938129005 28 Left 938128993 2:128694603-128694625 CCTCAGGCCTCCCCTGGGGTGAT No data
Right 938129005 2:128694654-128694676 CTGGCCCCTGCCTGTGGCCATGG No data
938128999_938129005 1 Left 938128999 2:128694630-128694652 CCCCGCAGCGTTGCCGTCTGGTC No data
Right 938129005 2:128694654-128694676 CTGGCCCCTGCCTGTGGCCATGG No data
938129000_938129005 0 Left 938129000 2:128694631-128694653 CCCGCAGCGTTGCCGTCTGGTCT No data
Right 938129005 2:128694654-128694676 CTGGCCCCTGCCTGTGGCCATGG No data
938129001_938129005 -1 Left 938129001 2:128694632-128694654 CCGCAGCGTTGCCGTCTGGTCTC No data
Right 938129005 2:128694654-128694676 CTGGCCCCTGCCTGTGGCCATGG No data
938128996_938129005 17 Left 938128996 2:128694614-128694636 CCCTGGGGTGATGCTGCCCCGCA No data
Right 938129005 2:128694654-128694676 CTGGCCCCTGCCTGTGGCCATGG No data
938128997_938129005 16 Left 938128997 2:128694615-128694637 CCTGGGGTGATGCTGCCCCGCAG No data
Right 938129005 2:128694654-128694676 CTGGCCCCTGCCTGTGGCCATGG No data
938128995_938129005 18 Left 938128995 2:128694613-128694635 CCCCTGGGGTGATGCTGCCCCGC No data
Right 938129005 2:128694654-128694676 CTGGCCCCTGCCTGTGGCCATGG No data
938128994_938129005 21 Left 938128994 2:128694610-128694632 CCTCCCCTGGGGTGATGCTGCCC No data
Right 938129005 2:128694654-128694676 CTGGCCCCTGCCTGTGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938129005 Original CRISPR CTGGCCCCTGCCTGTGGCCA TGG Intergenic