ID: 938133110

View in Genome Browser
Species Human (GRCh38)
Location 2:128734044-128734066
Sequence GCAGCTACTATGTTAAGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938133110_938133117 25 Left 938133110 2:128734044-128734066 CCATAGCTTAACATAGTAGCTGC No data
Right 938133117 2:128734092-128734114 CTTGCCTGTTAGTCTGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938133110 Original CRISPR GCAGCTACTATGTTAAGCTA TGG (reversed) Intergenic
No off target data available for this crispr