ID: 938134016

View in Genome Browser
Species Human (GRCh38)
Location 2:128739020-128739042
Sequence GTGGCTAATTTTCAGCTGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938134012_938134016 -1 Left 938134012 2:128738998-128739020 CCCTGTAGCCTGGGAAATGTTTG No data
Right 938134016 2:128739020-128739042 GTGGCTAATTTTCAGCTGACCGG No data
938134007_938134016 23 Left 938134007 2:128738974-128738996 CCTGCTTTGCCGCCATCACTTGC No data
Right 938134016 2:128739020-128739042 GTGGCTAATTTTCAGCTGACCGG No data
938134015_938134016 -9 Left 938134015 2:128739006-128739028 CCTGGGAAATGTTTGTGGCTAAT No data
Right 938134016 2:128739020-128739042 GTGGCTAATTTTCAGCTGACCGG No data
938134009_938134016 11 Left 938134009 2:128738986-128739008 CCATCACTTGCTCCCTGTAGCCT No data
Right 938134016 2:128739020-128739042 GTGGCTAATTTTCAGCTGACCGG No data
938134008_938134016 14 Left 938134008 2:128738983-128739005 CCGCCATCACTTGCTCCCTGTAG No data
Right 938134016 2:128739020-128739042 GTGGCTAATTTTCAGCTGACCGG No data
938134013_938134016 -2 Left 938134013 2:128738999-128739021 CCTGTAGCCTGGGAAATGTTTGT No data
Right 938134016 2:128739020-128739042 GTGGCTAATTTTCAGCTGACCGG No data
938134006_938134016 30 Left 938134006 2:128738967-128738989 CCAGCAGCCTGCTTTGCCGCCAT No data
Right 938134016 2:128739020-128739042 GTGGCTAATTTTCAGCTGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938134016 Original CRISPR GTGGCTAATTTTCAGCTGAC CGG Intergenic
No off target data available for this crispr