ID: 938134044

View in Genome Browser
Species Human (GRCh38)
Location 2:128739206-128739228
Sequence GTCCCTCAGCCTGAGATCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938134044_938134046 17 Left 938134044 2:128739206-128739228 CCTGAGATCTCAGGCTGAGGGAC No data
Right 938134046 2:128739246-128739268 AACTTGCAAGAGCTTAGTGATGG No data
938134044_938134047 27 Left 938134044 2:128739206-128739228 CCTGAGATCTCAGGCTGAGGGAC No data
Right 938134047 2:128739256-128739278 AGCTTAGTGATGGTTAATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938134044 Original CRISPR GTCCCTCAGCCTGAGATCTC AGG (reversed) Intergenic
No off target data available for this crispr