ID: 938135881

View in Genome Browser
Species Human (GRCh38)
Location 2:128756041-128756063
Sequence GTCCCACGGGACCACCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938135875_938135881 23 Left 938135875 2:128755995-128756017 CCTGTGGGCTGTGGGGAGAGAAG No data
Right 938135881 2:128756041-128756063 GTCCCACGGGACCACCTGCCAGG No data
938135874_938135881 27 Left 938135874 2:128755991-128756013 CCATCCTGTGGGCTGTGGGGAGA No data
Right 938135881 2:128756041-128756063 GTCCCACGGGACCACCTGCCAGG No data
938135872_938135881 29 Left 938135872 2:128755989-128756011 CCCCATCCTGTGGGCTGTGGGGA No data
Right 938135881 2:128756041-128756063 GTCCCACGGGACCACCTGCCAGG No data
938135873_938135881 28 Left 938135873 2:128755990-128756012 CCCATCCTGTGGGCTGTGGGGAG No data
Right 938135881 2:128756041-128756063 GTCCCACGGGACCACCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938135881 Original CRISPR GTCCCACGGGACCACCTGCC AGG Intergenic
No off target data available for this crispr