ID: 938136365

View in Genome Browser
Species Human (GRCh38)
Location 2:128761072-128761094
Sequence TCTAATATGCAGAGTCTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938136365_938136367 24 Left 938136365 2:128761072-128761094 CCTTGTAGACTCTGCATATTAGA No data
Right 938136367 2:128761119-128761141 AAAATTTTCTCCCATTCTCTAGG 0: 167
1: 9661
2: 15542
3: 11407
4: 7676
938136365_938136366 -9 Left 938136365 2:128761072-128761094 CCTTGTAGACTCTGCATATTAGA No data
Right 938136366 2:128761086-128761108 CATATTAGAACATTGTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938136365 Original CRISPR TCTAATATGCAGAGTCTACA AGG (reversed) Intergenic
No off target data available for this crispr