ID: 938138630

View in Genome Browser
Species Human (GRCh38)
Location 2:128779350-128779372
Sequence ACATGCATGCGGAGGCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938138630_938138637 29 Left 938138630 2:128779350-128779372 CCATCCAGCCTCCGCATGCATGT No data
Right 938138637 2:128779402-128779424 TTGCCATCAGACCACTCCCATGG No data
938138630_938138638 30 Left 938138630 2:128779350-128779372 CCATCCAGCCTCCGCATGCATGT No data
Right 938138638 2:128779403-128779425 TGCCATCAGACCACTCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938138630 Original CRISPR ACATGCATGCGGAGGCTGGA TGG (reversed) Intergenic
No off target data available for this crispr