ID: 938138637

View in Genome Browser
Species Human (GRCh38)
Location 2:128779402-128779424
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938138633_938138637 18 Left 938138633 2:128779361-128779383 CCGCATGCATGTTACCGAATTCC No data
Right 938138637 2:128779402-128779424 TTGCCATCAGACCACTCCCATGG No data
938138631_938138637 25 Left 938138631 2:128779354-128779376 CCAGCCTCCGCATGCATGTTACC No data
Right 938138637 2:128779402-128779424 TTGCCATCAGACCACTCCCATGG No data
938138635_938138637 -3 Left 938138635 2:128779382-128779404 CCACTTCAGTCACCTTGCTGTTG No data
Right 938138637 2:128779402-128779424 TTGCCATCAGACCACTCCCATGG No data
938138630_938138637 29 Left 938138630 2:128779350-128779372 CCATCCAGCCTCCGCATGCATGT No data
Right 938138637 2:128779402-128779424 TTGCCATCAGACCACTCCCATGG No data
938138632_938138637 21 Left 938138632 2:128779358-128779380 CCTCCGCATGCATGTTACCGAAT No data
Right 938138637 2:128779402-128779424 TTGCCATCAGACCACTCCCATGG No data
938138634_938138637 4 Left 938138634 2:128779375-128779397 CCGAATTCCACTTCAGTCACCTT No data
Right 938138637 2:128779402-128779424 TTGCCATCAGACCACTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type