ID: 938138638

View in Genome Browser
Species Human (GRCh38)
Location 2:128779403-128779425
Sequence TGCCATCAGACCACTCCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938138632_938138638 22 Left 938138632 2:128779358-128779380 CCTCCGCATGCATGTTACCGAAT No data
Right 938138638 2:128779403-128779425 TGCCATCAGACCACTCCCATGGG No data
938138630_938138638 30 Left 938138630 2:128779350-128779372 CCATCCAGCCTCCGCATGCATGT No data
Right 938138638 2:128779403-128779425 TGCCATCAGACCACTCCCATGGG No data
938138633_938138638 19 Left 938138633 2:128779361-128779383 CCGCATGCATGTTACCGAATTCC No data
Right 938138638 2:128779403-128779425 TGCCATCAGACCACTCCCATGGG No data
938138631_938138638 26 Left 938138631 2:128779354-128779376 CCAGCCTCCGCATGCATGTTACC No data
Right 938138638 2:128779403-128779425 TGCCATCAGACCACTCCCATGGG No data
938138634_938138638 5 Left 938138634 2:128779375-128779397 CCGAATTCCACTTCAGTCACCTT No data
Right 938138638 2:128779403-128779425 TGCCATCAGACCACTCCCATGGG No data
938138635_938138638 -2 Left 938138635 2:128779382-128779404 CCACTTCAGTCACCTTGCTGTTG No data
Right 938138638 2:128779403-128779425 TGCCATCAGACCACTCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938138638 Original CRISPR TGCCATCAGACCACTCCCAT GGG Intergenic
No off target data available for this crispr