ID: 938139404

View in Genome Browser
Species Human (GRCh38)
Location 2:128783679-128783701
Sequence ACCATGGTTTCCACTCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938139388_938139404 29 Left 938139388 2:128783627-128783649 CCTCTCAGCCCCCCCAGAGCATA No data
Right 938139404 2:128783679-128783701 ACCATGGTTTCCACTCTCAAGGG No data
938139393_938139404 17 Left 938139393 2:128783639-128783661 CCCAGAGCATATACAGTGTTGTT No data
Right 938139404 2:128783679-128783701 ACCATGGTTTCCACTCTCAAGGG No data
938139390_938139404 20 Left 938139390 2:128783636-128783658 CCCCCCAGAGCATATACAGTGTT No data
Right 938139404 2:128783679-128783701 ACCATGGTTTCCACTCTCAAGGG No data
938139389_938139404 21 Left 938139389 2:128783635-128783657 CCCCCCCAGAGCATATACAGTGT No data
Right 938139404 2:128783679-128783701 ACCATGGTTTCCACTCTCAAGGG No data
938139394_938139404 16 Left 938139394 2:128783640-128783662 CCAGAGCATATACAGTGTTGTTG No data
Right 938139404 2:128783679-128783701 ACCATGGTTTCCACTCTCAAGGG No data
938139396_938139404 -10 Left 938139396 2:128783666-128783688 CCCCAGCTCCCCCACCATGGTTT No data
Right 938139404 2:128783679-128783701 ACCATGGTTTCCACTCTCAAGGG No data
938139391_938139404 19 Left 938139391 2:128783637-128783659 CCCCCAGAGCATATACAGTGTTG No data
Right 938139404 2:128783679-128783701 ACCATGGTTTCCACTCTCAAGGG No data
938139392_938139404 18 Left 938139392 2:128783638-128783660 CCCCAGAGCATATACAGTGTTGT No data
Right 938139404 2:128783679-128783701 ACCATGGTTTCCACTCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938139404 Original CRISPR ACCATGGTTTCCACTCTCAA GGG Intergenic
No off target data available for this crispr