ID: 938140237

View in Genome Browser
Species Human (GRCh38)
Location 2:128789466-128789488
Sequence CTTTGGACTCACGTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938140237_938140245 8 Left 938140237 2:128789466-128789488 CCCAGCTCCACGTGAGTCCAAAG No data
Right 938140245 2:128789497-128789519 GTCCCTGTGTGTTCTCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938140237 Original CRISPR CTTTGGACTCACGTGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr