ID: 938147477

View in Genome Browser
Species Human (GRCh38)
Location 2:128848821-128848843
Sequence GGTCTTCAGTGGACACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938147477_938147482 11 Left 938147477 2:128848821-128848843 CCAGCTTGTGTCCACTGAAGACC No data
Right 938147482 2:128848855-128848877 TAGGAAAAAATCCCCACATCTGG No data
938147477_938147479 -8 Left 938147477 2:128848821-128848843 CCAGCTTGTGTCCACTGAAGACC No data
Right 938147479 2:128848836-128848858 TGAAGACCTCCTTTGTGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938147477 Original CRISPR GGTCTTCAGTGGACACAAGC TGG (reversed) Intergenic
No off target data available for this crispr