ID: 938153749

View in Genome Browser
Species Human (GRCh38)
Location 2:128909937-128909959
Sequence CCTCACTGAAGGAGGCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938153749_938153759 23 Left 938153749 2:128909937-128909959 CCCCCCAGCCTCCTTCAGTGAGG No data
Right 938153759 2:128909983-128910005 GTTAAATTGTTTTGTCAGCCGGG No data
938153749_938153758 22 Left 938153749 2:128909937-128909959 CCCCCCAGCCTCCTTCAGTGAGG No data
Right 938153758 2:128909982-128910004 AGTTAAATTGTTTTGTCAGCCGG No data
938153749_938153760 28 Left 938153749 2:128909937-128909959 CCCCCCAGCCTCCTTCAGTGAGG No data
Right 938153760 2:128909988-128910010 ATTGTTTTGTCAGCCGGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938153749 Original CRISPR CCTCACTGAAGGAGGCTGGG GGG (reversed) Intergenic
No off target data available for this crispr