ID: 938155377

View in Genome Browser
Species Human (GRCh38)
Location 2:128934142-128934164
Sequence GGAATTGAACCAGTGTGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938155377_938155385 19 Left 938155377 2:128934142-128934164 CCTCAACACACTGGTTCAATTCC No data
Right 938155385 2:128934184-128934206 GTGGGATTCTGGATCACATTTGG No data
938155377_938155381 1 Left 938155377 2:128934142-128934164 CCTCAACACACTGGTTCAATTCC No data
Right 938155381 2:128934166-128934188 TTGGATATATACCCAACAGTGGG 0: 8
1: 186
2: 1083
3: 4379
4: 26556
938155377_938155382 8 Left 938155377 2:128934142-128934164 CCTCAACACACTGGTTCAATTCC No data
Right 938155382 2:128934173-128934195 TATACCCAACAGTGGGATTCTGG No data
938155377_938155380 0 Left 938155377 2:128934142-128934164 CCTCAACACACTGGTTCAATTCC No data
Right 938155380 2:128934165-128934187 TTTGGATATATACCCAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938155377 Original CRISPR GGAATTGAACCAGTGTGTTG AGG (reversed) Intergenic
No off target data available for this crispr