ID: 938155893

View in Genome Browser
Species Human (GRCh38)
Location 2:128939684-128939706
Sequence AGCAAAGCCTGCCCAACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938155893_938155901 25 Left 938155893 2:128939684-128939706 CCCTCTGTTGGGCAGGCTTTGCT No data
Right 938155901 2:128939732-128939754 GGATGTCAGACGTCATTGACAGG No data
938155893_938155897 -2 Left 938155893 2:128939684-128939706 CCCTCTGTTGGGCAGGCTTTGCT No data
Right 938155897 2:128939705-128939727 CTCTGGATCTCCCATTGGATTGG No data
938155893_938155902 30 Left 938155893 2:128939684-128939706 CCCTCTGTTGGGCAGGCTTTGCT No data
Right 938155902 2:128939737-128939759 TCAGACGTCATTGACAGGTGAGG No data
938155893_938155896 -7 Left 938155893 2:128939684-128939706 CCCTCTGTTGGGCAGGCTTTGCT No data
Right 938155896 2:128939700-128939722 CTTTGCTCTGGATCTCCCATTGG No data
938155893_938155898 4 Left 938155893 2:128939684-128939706 CCCTCTGTTGGGCAGGCTTTGCT No data
Right 938155898 2:128939711-128939733 ATCTCCCATTGGATTGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938155893 Original CRISPR AGCAAAGCCTGCCCAACAGA GGG (reversed) Intergenic
No off target data available for this crispr