ID: 938159442

View in Genome Browser
Species Human (GRCh38)
Location 2:128972619-128972641
Sequence AGGAAGGTTTCACGATGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938159442_938159449 9 Left 938159442 2:128972619-128972641 CCTAAGCATCGTGAAACCTTCCT No data
Right 938159449 2:128972651-128972673 CTGAGTGCAGGCTGGACGCCTGG No data
938159442_938159447 1 Left 938159442 2:128972619-128972641 CCTAAGCATCGTGAAACCTTCCT No data
Right 938159447 2:128972643-128972665 CCGCTCCGCTGAGTGCAGGCTGG No data
938159442_938159451 25 Left 938159442 2:128972619-128972641 CCTAAGCATCGTGAAACCTTCCT No data
Right 938159451 2:128972667-128972689 CGCCTGGCCCTGGCCTTGAGTGG No data
938159442_938159445 -3 Left 938159442 2:128972619-128972641 CCTAAGCATCGTGAAACCTTCCT No data
Right 938159445 2:128972639-128972661 CCTTCCGCTCCGCTGAGTGCAGG No data
938159442_938159450 15 Left 938159442 2:128972619-128972641 CCTAAGCATCGTGAAACCTTCCT No data
Right 938159450 2:128972657-128972679 GCAGGCTGGACGCCTGGCCCTGG No data
938159442_938159453 30 Left 938159442 2:128972619-128972641 CCTAAGCATCGTGAAACCTTCCT No data
Right 938159453 2:128972672-128972694 GGCCCTGGCCTTGAGTGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938159442 Original CRISPR AGGAAGGTTTCACGATGCTT AGG (reversed) Intergenic