ID: 938159443

View in Genome Browser
Species Human (GRCh38)
Location 2:128972635-128972657
Sequence CACTCAGCGGAGCGGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938159443_938159453 14 Left 938159443 2:128972635-128972657 CCTTCCTTCCGCTCCGCTGAGTG No data
Right 938159453 2:128972672-128972694 GGCCCTGGCCTTGAGTGGACAGG No data
938159443_938159458 24 Left 938159443 2:128972635-128972657 CCTTCCTTCCGCTCCGCTGAGTG No data
Right 938159458 2:128972682-128972704 TTGAGTGGACAGGCTAAAGGTGG No data
938159443_938159451 9 Left 938159443 2:128972635-128972657 CCTTCCTTCCGCTCCGCTGAGTG No data
Right 938159451 2:128972667-128972689 CGCCTGGCCCTGGCCTTGAGTGG No data
938159443_938159456 21 Left 938159443 2:128972635-128972657 CCTTCCTTCCGCTCCGCTGAGTG No data
Right 938159456 2:128972679-128972701 GCCTTGAGTGGACAGGCTAAAGG No data
938159443_938159449 -7 Left 938159443 2:128972635-128972657 CCTTCCTTCCGCTCCGCTGAGTG No data
Right 938159449 2:128972651-128972673 CTGAGTGCAGGCTGGACGCCTGG No data
938159443_938159459 25 Left 938159443 2:128972635-128972657 CCTTCCTTCCGCTCCGCTGAGTG No data
Right 938159459 2:128972683-128972705 TGAGTGGACAGGCTAAAGGTGGG No data
938159443_938159450 -1 Left 938159443 2:128972635-128972657 CCTTCCTTCCGCTCCGCTGAGTG No data
Right 938159450 2:128972657-128972679 GCAGGCTGGACGCCTGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938159443 Original CRISPR CACTCAGCGGAGCGGAAGGA AGG (reversed) Intergenic