ID: 938159444

View in Genome Browser
Species Human (GRCh38)
Location 2:128972639-128972661
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938159444_938159458 20 Left 938159444 2:128972639-128972661 CCTTCCGCTCCGCTGAGTGCAGG No data
Right 938159458 2:128972682-128972704 TTGAGTGGACAGGCTAAAGGTGG No data
938159444_938159461 28 Left 938159444 2:128972639-128972661 CCTTCCGCTCCGCTGAGTGCAGG No data
Right 938159461 2:128972690-128972712 ACAGGCTAAAGGTGGGAAATGGG No data
938159444_938159451 5 Left 938159444 2:128972639-128972661 CCTTCCGCTCCGCTGAGTGCAGG No data
Right 938159451 2:128972667-128972689 CGCCTGGCCCTGGCCTTGAGTGG No data
938159444_938159450 -5 Left 938159444 2:128972639-128972661 CCTTCCGCTCCGCTGAGTGCAGG No data
Right 938159450 2:128972657-128972679 GCAGGCTGGACGCCTGGCCCTGG No data
938159444_938159456 17 Left 938159444 2:128972639-128972661 CCTTCCGCTCCGCTGAGTGCAGG No data
Right 938159456 2:128972679-128972701 GCCTTGAGTGGACAGGCTAAAGG No data
938159444_938159462 29 Left 938159444 2:128972639-128972661 CCTTCCGCTCCGCTGAGTGCAGG No data
Right 938159462 2:128972691-128972713 CAGGCTAAAGGTGGGAAATGGGG No data
938159444_938159460 27 Left 938159444 2:128972639-128972661 CCTTCCGCTCCGCTGAGTGCAGG No data
Right 938159460 2:128972689-128972711 GACAGGCTAAAGGTGGGAAATGG No data
938159444_938159453 10 Left 938159444 2:128972639-128972661 CCTTCCGCTCCGCTGAGTGCAGG No data
Right 938159453 2:128972672-128972694 GGCCCTGGCCTTGAGTGGACAGG No data
938159444_938159459 21 Left 938159444 2:128972639-128972661 CCTTCCGCTCCGCTGAGTGCAGG No data
Right 938159459 2:128972683-128972705 TGAGTGGACAGGCTAAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938159444 Original CRISPR CCTGCACTCAGCGGAGCGGA AGG (reversed) Intergenic