ID: 938159448

View in Genome Browser
Species Human (GRCh38)
Location 2:128972648-128972670
Sequence GGCGTCCAGCCTGCACTCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938159448_938159458 11 Left 938159448 2:128972648-128972670 CCGCTGAGTGCAGGCTGGACGCC No data
Right 938159458 2:128972682-128972704 TTGAGTGGACAGGCTAAAGGTGG No data
938159448_938159456 8 Left 938159448 2:128972648-128972670 CCGCTGAGTGCAGGCTGGACGCC No data
Right 938159456 2:128972679-128972701 GCCTTGAGTGGACAGGCTAAAGG No data
938159448_938159463 29 Left 938159448 2:128972648-128972670 CCGCTGAGTGCAGGCTGGACGCC No data
Right 938159463 2:128972700-128972722 GGTGGGAAATGGGGTACTCTTGG No data
938159448_938159460 18 Left 938159448 2:128972648-128972670 CCGCTGAGTGCAGGCTGGACGCC No data
Right 938159460 2:128972689-128972711 GACAGGCTAAAGGTGGGAAATGG No data
938159448_938159464 30 Left 938159448 2:128972648-128972670 CCGCTGAGTGCAGGCTGGACGCC No data
Right 938159464 2:128972701-128972723 GTGGGAAATGGGGTACTCTTGGG No data
938159448_938159453 1 Left 938159448 2:128972648-128972670 CCGCTGAGTGCAGGCTGGACGCC No data
Right 938159453 2:128972672-128972694 GGCCCTGGCCTTGAGTGGACAGG No data
938159448_938159459 12 Left 938159448 2:128972648-128972670 CCGCTGAGTGCAGGCTGGACGCC No data
Right 938159459 2:128972683-128972705 TGAGTGGACAGGCTAAAGGTGGG No data
938159448_938159451 -4 Left 938159448 2:128972648-128972670 CCGCTGAGTGCAGGCTGGACGCC No data
Right 938159451 2:128972667-128972689 CGCCTGGCCCTGGCCTTGAGTGG No data
938159448_938159462 20 Left 938159448 2:128972648-128972670 CCGCTGAGTGCAGGCTGGACGCC No data
Right 938159462 2:128972691-128972713 CAGGCTAAAGGTGGGAAATGGGG No data
938159448_938159461 19 Left 938159448 2:128972648-128972670 CCGCTGAGTGCAGGCTGGACGCC No data
Right 938159461 2:128972690-128972712 ACAGGCTAAAGGTGGGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938159448 Original CRISPR GGCGTCCAGCCTGCACTCAG CGG (reversed) Intergenic